Review





Similar Products

sgrna mediated gene deletion nonspecific control sirna  (Sangon Biotech)
86
Sangon Biotech sgrna mediated gene deletion nonspecific control sirna
Sgrna Mediated Gene Deletion Nonspecific Control Sirna, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/control+negative+sirna/pm41857057-326-3-19
Average 86 stars, based on 1 article reviews
sgrna mediated gene deletion nonspecific control sirna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
non targeting nt control sgrna  (Addgene inc)
96
Addgene inc non targeting nt control sgrna
Non Targeting Nt Control Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/lentiCRISPR+v2+(Plasmid+%2352961)/pm41840739-171-12-20
Average 96 stars, based on 1 article reviews
non targeting nt control sgrna - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier
control sgrna  (Synthego Inc)
86
Synthego Inc control sgrna
Control Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/control+non+ntc+sgrna+targeting/pmc13171165-404-18-23
Average 86 stars, based on 1 article reviews
control sgrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
pu6 sgrna ef1α puro t2a mcherry vector  (Addgene inc)
93
Addgene inc pu6 sgrna ef1α puro t2a mcherry vector
Pu6 Sgrna Ef1α Puro T2a Mcherry Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/pU6-sgRNA+EF1Alpha-puro-T2A-BFP%2EControl+(Plasmid+%23128749)/bio_rxiv__64898__2025__12__29__696402-248-23-26
Average 93 stars, based on 1 article reviews
pu6 sgrna ef1α puro t2a mcherry vector - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
sgrna control  (Addgene inc)
93
Addgene inc sgrna control
Sgrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/pLenti+X2+Neo+DEST+(w18-1)+(Plasmid+%2317390)/pm41397992-269-26-28
Average 93 stars, based on 1 article reviews
sgrna control - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
scramble control sgrnas  (Synthego Inc)
86
Synthego Inc scramble control sgrnas
Scramble Control Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/control+scramble/bio_rxiv__2025__11__13__688264-374-16-22
Average 86 stars, based on 1 article reviews
scramble control sgrnas - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
negative control sgrna  (Synthego Inc)
86
Synthego Inc negative control sgrna
LINC00636 RNA expression is regulated by a bifunctional SE. (A) LINC00636 and CD47 RNA expression levels decrease upon BET inhibition in BCCL, and this reduction occurs at a greater extent in the cells where the SE is present. Cells were treated with 1 μM JQ1 or I-BET151 for 6 hours and mRNA levels were analyzed by qPCR. DMSO was used as vehicle control. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (B) CRISPRa of the SE locus increases LINC00636 and CD47 RNA expression levels, and this activation occurs at a greater extent in the cells where the SE is present. dCas9-VP64-expressing cells were transfected with scramble <t>sgRNA</t> or sgRNA targeting the E5 core element within the SE. mRNA levels were analyzed by qPCR 48 hours after transfection. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (C) LINC00636 overexpression does not affect CD47 RNA expression levels. Left image shows the CRISPRa approach used for LINC00636 overexpression targeting LINC00636 TSS. The plots show LINC00636 and CD47 RNA levels in dCas9-VP64-expressing MCF7 cells transfected <t>with</t> <t>sgRNAs</t> targeting two different sites on LINC00636 TSS. mRNA levels were analyzed by qPCR 48 hours after transfection. ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001.
Negative Control Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/control+non+ntc+sgrna+targeting/bio_rxiv__2025__11__05__684493-241-0-7
Average 86 stars, based on 1 article reviews
negative control sgrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
non targeting control sgrna  (Obio Technology Corp Ltd)
86
Obio Technology Corp Ltd non targeting control sgrna
LINC00636 RNA expression is regulated by a bifunctional SE. (A) LINC00636 and CD47 RNA expression levels decrease upon BET inhibition in BCCL, and this reduction occurs at a greater extent in the cells where the SE is present. Cells were treated with 1 μM JQ1 or I-BET151 for 6 hours and mRNA levels were analyzed by qPCR. DMSO was used as vehicle control. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (B) CRISPRa of the SE locus increases LINC00636 and CD47 RNA expression levels, and this activation occurs at a greater extent in the cells where the SE is present. dCas9-VP64-expressing cells were transfected with scramble <t>sgRNA</t> or sgRNA targeting the E5 core element within the SE. mRNA levels were analyzed by qPCR 48 hours after transfection. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (C) LINC00636 overexpression does not affect CD47 RNA expression levels. Left image shows the CRISPRa approach used for LINC00636 overexpression targeting LINC00636 TSS. The plots show LINC00636 and CD47 RNA levels in dCas9-VP64-expressing MCF7 cells transfected <t>with</t> <t>sgRNAs</t> targeting two different sites on LINC00636 TSS. mRNA levels were analyzed by qPCR 48 hours after transfection. ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001.
Non Targeting Control Sgrna, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/control+non+targeting/10__1007_slash_s44466___025___00013___1-200-22-55
Average 86 stars, based on 1 article reviews
non targeting control sgrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
targeting negative controls sgrna  (Synthego Inc)
86
Synthego Inc targeting negative controls sgrna
LINC00636 RNA expression is regulated by a bifunctional SE. (A) LINC00636 and CD47 RNA expression levels decrease upon BET inhibition in BCCL, and this reduction occurs at a greater extent in the cells where the SE is present. Cells were treated with 1 μM JQ1 or I-BET151 for 6 hours and mRNA levels were analyzed by qPCR. DMSO was used as vehicle control. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (B) CRISPRa of the SE locus increases LINC00636 and CD47 RNA expression levels, and this activation occurs at a greater extent in the cells where the SE is present. dCas9-VP64-expressing cells were transfected with scramble <t>sgRNA</t> or sgRNA targeting the E5 core element within the SE. mRNA levels were analyzed by qPCR 48 hours after transfection. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (C) LINC00636 overexpression does not affect CD47 RNA expression levels. Left image shows the CRISPRa approach used for LINC00636 overexpression targeting LINC00636 TSS. The plots show LINC00636 and CD47 RNA levels in dCas9-VP64-expressing MCF7 cells transfected <t>with</t> <t>sgRNAs</t> targeting two different sites on LINC00636 TSS. mRNA levels were analyzed by qPCR 48 hours after transfection. ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001.
Targeting Negative Controls Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/control+non+ntc+sgrna+targeting/pmc12822379-262-0-8
Average 86 stars, based on 1 article reviews
targeting negative controls sgrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier
negative controls sgrna  (Synthego Inc)
86
Synthego Inc negative controls sgrna
LINC00636 RNA expression is regulated by a bifunctional SE. (A) LINC00636 and CD47 RNA expression levels decrease upon BET inhibition in BCCL, and this reduction occurs at a greater extent in the cells where the SE is present. Cells were treated with 1 μM JQ1 or I-BET151 for 6 hours and mRNA levels were analyzed by qPCR. DMSO was used as vehicle control. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (B) CRISPRa of the SE locus increases LINC00636 and CD47 RNA expression levels, and this activation occurs at a greater extent in the cells where the SE is present. dCas9-VP64-expressing cells were transfected with scramble <t>sgRNA</t> or sgRNA targeting the E5 core element within the SE. mRNA levels were analyzed by qPCR 48 hours after transfection. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (C) LINC00636 overexpression does not affect CD47 RNA expression levels. Left image shows the CRISPRa approach used for LINC00636 overexpression targeting LINC00636 TSS. The plots show LINC00636 and CD47 RNA levels in dCas9-VP64-expressing MCF7 cells transfected <t>with</t> <t>sgRNAs</t> targeting two different sites on LINC00636 TSS. mRNA levels were analyzed by qPCR 48 hours after transfection. ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001.
Negative Controls Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sgrna+control/controls+negative+sgrna/pm41178490-364-1-8
Average 86 stars, based on 1 article reviews
negative controls sgrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


LINC00636 RNA expression is regulated by a bifunctional SE. (A) LINC00636 and CD47 RNA expression levels decrease upon BET inhibition in BCCL, and this reduction occurs at a greater extent in the cells where the SE is present. Cells were treated with 1 μM JQ1 or I-BET151 for 6 hours and mRNA levels were analyzed by qPCR. DMSO was used as vehicle control. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (B) CRISPRa of the SE locus increases LINC00636 and CD47 RNA expression levels, and this activation occurs at a greater extent in the cells where the SE is present. dCas9-VP64-expressing cells were transfected with scramble sgRNA or sgRNA targeting the E5 core element within the SE. mRNA levels were analyzed by qPCR 48 hours after transfection. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (C) LINC00636 overexpression does not affect CD47 RNA expression levels. Left image shows the CRISPRa approach used for LINC00636 overexpression targeting LINC00636 TSS. The plots show LINC00636 and CD47 RNA levels in dCas9-VP64-expressing MCF7 cells transfected with sgRNAs targeting two different sites on LINC00636 TSS. mRNA levels were analyzed by qPCR 48 hours after transfection. ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001.

Journal: bioRxiv

Article Title: An InDel Genomic Variant within a Bifunctional Super-Enhancer for LINC00636 and CD47 Regulation in Breast Cancer

doi: 10.1101/2025.11.05.684493

Figure Lengend Snippet: LINC00636 RNA expression is regulated by a bifunctional SE. (A) LINC00636 and CD47 RNA expression levels decrease upon BET inhibition in BCCL, and this reduction occurs at a greater extent in the cells where the SE is present. Cells were treated with 1 μM JQ1 or I-BET151 for 6 hours and mRNA levels were analyzed by qPCR. DMSO was used as vehicle control. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (B) CRISPRa of the SE locus increases LINC00636 and CD47 RNA expression levels, and this activation occurs at a greater extent in the cells where the SE is present. dCas9-VP64-expressing cells were transfected with scramble sgRNA or sgRNA targeting the E5 core element within the SE. mRNA levels were analyzed by qPCR 48 hours after transfection. Two-way ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001. (C) LINC00636 overexpression does not affect CD47 RNA expression levels. Left image shows the CRISPRa approach used for LINC00636 overexpression targeting LINC00636 TSS. The plots show LINC00636 and CD47 RNA levels in dCas9-VP64-expressing MCF7 cells transfected with sgRNAs targeting two different sites on LINC00636 TSS. mRNA levels were analyzed by qPCR 48 hours after transfection. ANOVA was performed, *p<0.05, **p<0.01, ***p<0.001.

Article Snippet: Negative Control sgRNA (Scrambled sgRNA#1) was from Synthego. sgRNAs target sequences were as follows: sgRNA SE: AAAATACGGTTACTGTGATT sgRNA#1: TCTAGATCTCCCTTTGGTGC sgRNA#2: CTAGAGCAAAAGCTGCTTGT

Techniques: RNA Expression, Inhibition, Control, Activation Assay, Expressing, Transfection, Over Expression